• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    LACTIC BACTERIA FOR TEXTURIZING FOOD PRODUCTS SELECTED IN THE PEST RESISTANCE BASES. The present invention relates to the bacterial cell with texturing property, starter cultures comprising the cell and daily products fermented with the starter culture.
    公开号:BR112012018882B1
    申请号:R112012018882-8
    申请日:2011-01-28
    公开日:2020-12-01
    发明作者:Thomas Janzen；Ditte Ellegaard Christiansen
    申请人:Chr. Hansen A/S；
    IPC主号:
    专利说明:

    [0001] [001] The present invention relates to a bacterial cell that has improved resistance to phage, starting cultures comprising the cell, and dairy products fermented with the starting culture. Background of the Invention
    [0002] [002] The food industry uses numerous bacteria, in particular lactic acid bacteria, in order to improve the taste and texture of food but also in order to extend the shelf life of these foods. In the case of the dairy industry, lactic acid bacteria are used intensively in order to effect the acidulation of milk (through fermentation) but also in order to texture the product in which they are incorporated.
    [0003] [003] Among the lactic acid bacteria used in the food industry, the genera Streptococcus, Lactococcus, Lactobacillus, Leuconostoc, Pediococcus and Bifidobacterium can be mentioned. Lactic acid bacteria of the species Streptococcus thermophilus are extensively used alone or in combination with other bacteria for the production of food products, in particular fermented products. They are used in particular in the formulation of yeasts used for the production of fermented milk, for example, yoghurts. Certain of these play a dominant role in the development of the fermented product's texture. This characteristic is closely linked to the production of polysaccharides. Among the strains of Streptococcus thermophilus it is possible to distinguish texturing and non-texturing strains.
    [0004] [004] WO2007095958A1 shows strains of Streptococcus thermophilus with texturing properties. In figure 1 it can be seen that the most texturizing strain CHCC8833 (DSM17876) has a shear stress value around 59 Pa.
    [0005] [005] Vedamuthu et al: "Involvement of a plasmid in production of ropiness mucoidness in milk cultures by Streptococcus cremoris MS", Applied and Environmental Microbiology, vol. 51, no. 4, 1986, pages 677-682 discusses the ability of strains to produce slime that provides a viscous consistency in fermented milk products. The use of such strains for the production of extremely viscous Scandinavian sour milk products such as taette, Swedish lang mjolk and Finish villii is suggested.
    [0006] [006] Akcelik & Sanlibaba: "Characterization of an exopolysaccharide preventing phage adsorption in Lactococcus lactis subsp. Cremoris MA39", Turkish Journal Veterinary Animal 35 Science, vol. 26, 2002, pages 1151-1156 describes a strain of Lactococcus lactis subsp. cremoris MA39 that produces an extracellular polysaccharide containing rhamnose, glucose and galactose. While the polysaccharide was detected as preventing adsorption to the phage, the publication does not describe that resistance to the phage can contribute to the texturing properties of a lactic acid strain.
    [0007] [007] Robitaille et al: "Fat-free yogurt made using a galactose-positive exopolysaccharide-producing recombinant strain of Streptococcus thermophilus", Journal Of Dairy Science, American Dairy Science Association, US, vol. 92, no. 2, 1 February 2009, pages 477-482 reports the generation of the exopolysaccharide (EPS) producing strain RD-534-S1 that houses a plasmid with a recombinant galK gene. When using a starting culture with strain RD-534-S1 to produce yogurt, no increase in viscosity was observed with respect to a starting culture comprising mother strain RD-534 that does not include the galK gene.
    [0008] [008] Vaillancourt et al: "Characterization of a galactokinase-posi-had recombinant strain of Streptococcus thermophilus", Applied And Environmental Microbiology, American Society For Microbiology, US, vol. 70, no. 8, 1 August 2004, pages 4596-4603 describes a recombinant strain of Streptococcus thermophilus and its potential use as a starter culture for dairy products. The publication does not mention the texturizing properties of this strain or the relevance of phage resistance to the ability of a strain to impart texture to milk products.
    [0009] [009] In order to satisfy industry requirements, it became necessary to provide new texturing strains of lactic acid bacteria, in particular Streptococcus thermophilus, for texturing food products. In particular, there is a need for a new texturizing strain of Streptococcus thermophilus that can be used in conjunction with a strain of a Lactobacillus species. Another industry need is for the strain to be resistant to bacteriophages normally found in the food industry. Summary of the Invention
    [0010] [0010] The present inventors have provided a new group of lactic acid bacteria of the species Streptococcus thermophilus and Lactobacillus bulgaricus, which surprisingly is more resistant to phage attack than the strain from which (mother) is obtained. Still, it is surprisingly found that this group of bacteria generates greater shear stress and / or gel stiffness than the mother strain when the bacteria are used for milk fermentation.
    [0011] [0011] It is surprising that a mutant phage-resistant strain gives more texture, for example, greater shear stress and / or gel stiffness, (when the strain is used to ferment milk) than the mother strain, and it is especially surprising that a mutant phage-resistant strain of a strain that (also) contains a mutation in the galK gene (in relation to the wild type strain) gives more texture (when the strain is used to ferment milk) than the parent strain.
    [0012] a) provimento de uma cepa bacteriana de ácido lático (a cepa mãe); b) exposição da cepa mãe a um bacteriófago que é capaz de lisar a cepa mãe; c) isolamento de uma cepa mutante da cepa mãe, cuja cepa mutante não é lisada pelo bacteriófago; d) introdução de uma mutação na sequência reguladora galK da cepa antes, durante e/ou após a etapa b); em que a referida cepa mutante gera tensão de cisalhamento e/ou rigidez de gel superior à cepa mãe quando usada para fermentação de leite.[0012] According to the surprising findings above, the present invention relates to a process for manufacturing a lactic acid bacteria strain of texturizing by selecting phage-resistant mutants from a parent strain, and introducing a mutation in the sequence galK regulator of the strain. More specifically, the invention relates to a process for manufacturing a texturizing lactic acid bacteria (for example, a bacterium that, in addition to being, for example, phage resistant, substantially phage resistant, and / or having increased resistance to compared to the mother strain, it is more texturizing than the mother strain), comprising the steps of: a) provision of a bacterial strain of lactic acid (the parent strain); b) exposure of the mother strain to a bacteriophage that is capable of smoothing the mother strain; c) isolation of a mutant strain from the mother strain, whose mutant strain is not lysed by the bacteriophage; d) introducing a mutation in the regulatory sequence galK of the strain before, during and / or after step b); wherein said mutant strain generates shear stress and / or gel stiffness higher than the mother strain when used for milk fermentation.
    [0013] [0013] The invention also relates to strains of texturizing bacteria belonging to the species Streptococcus thermophilus or Lactobacillus delbrueckii sbsp. bulgaricus that were obtained by the above mentioned process. Compositions comprising these strains and processes for producing a fermented milk product that makes use of these strains are also provided. Detailed Exhibition
    [0014] a) provimento de uma cepa bacteriana de ácido lático (a cepa mãe); b) exposição da cepa mãe a um bacteriófago que é capaz de lisar a cepa mãe; c) isolamento de uma cepa mutante da cepa mãe, cuja cepa mutante não é lisada pelo bacteriófago; d) introdução de uma mutação na sequência reguladora galK da cepa antes, durante e/ou após a etapa b); em que a referida cepa mutante gera tensão de cisalhamento e/ou rigidez de gel superior à cepa mãe quando usada para fermentação de leite.[0014] In a first aspect, the present invention relates to a process for manufacturing a lactic acid bacterium (which is, for example, phage resistant, substantially phage resistant, and / or has increased phage resistance compared to to the mother strain, and that generates greater shear stress and / or gel stiffness than the mother strain when bacteria are used for milk fermentation), comprising the steps of: a) provision of a bacterial strain of lactic acid (the parent strain); b) exposure of the mother strain to a bacteriophage that is capable of smoothing the mother strain; c) isolation of a mutant strain from the mother strain, whose mutant strain is not lysed by the bacteriophage; d) introducing a mutation in the regulatory sequence galK of the strain before, during and / or after step b); wherein said mutant strain generates shear stress and / or gel stiffness higher than the mother strain when used for milk fermentation.
    [0015] [0015] The mutation introduced in the galK regulatory sequence (for example, promoter) of the strain can be introduced, for example, through chemical treatment or radiation treatment, or through genetic engineering techniques before, during or after step b) of the above process.
    [0016] - provimento de uma cepa bacteriana de ácido lático (a cepa mãe); - mutação (por exemplo, através de tratamento químico ou tratamento com radiação, ou por meio de técnicas de engenharia genética) de cepa mãe; - exposição de resultante cepa bacteriana lática a um bacte-riófago que é capaz de lisar a cepa mãe, tal como um fago selecionado do grupo consistindo em CHPC658, CHPC1057, CHPC1089 e CHPC1152; - incubação de células bacterianas expostas em um meio de crescimento; e - isolamento de uma cepa mutante da cepa mãe, cuja cepa mutante não é lisada pelo bacteriófago; [0016] In an interesting embodiment, a process of the invention comprises the steps of: - provision of a bacterial strain of lactic acid (the parent strain); - mutation (for example, through chemical treatment or radiation treatment, or through genetic engineering techniques) of the mother strain; - exposure of the resulting lactic bacterial strain to a bacte-riophage that is able to lyse the mother strain, such as a phage selected from the group consisting of CHPC658, CHPC1057, CHPC1089 and CHPC1152; - incubation of exposed bacterial cells in a growth medium; and - isolation of a mutant strain from the mother strain, whose mutant strain is not lysed by the bacteriophage;
    [0017] [0017] The process of the invention can lead to a mutation that is introduced in the promoter region of the galK gene, such as in the -10 region (the Pribnow box) or the region between the Pribnow box and the ribosome binding site.
    [0018] [0018] Also, the process of the invention can lead to a mutation resulting in increased fermentation activity compared to the mother strain.
    [0019] [0019] The mutation may result in the substitution of one or more nu-cleotides in the region between the Pribnow box and the galK gene ribosome binding site, such as a C replacement in the TTCAGT sequence downstream of the Pribnow type box with a nucleotide selected from the group consisting of A, T and G.
    [0020] - a substituição de um ou mais nucleotídeos na região entre a caixa Pribnow e o sítio de ligação de ribossoma do gene galK, tal como substituição de C na sequência TTCAGT (SEQ ID NO: 6) à jusante a partir da caixa Pribnow tipo selvagem com um nucleotídeo selecionado do grupo consistindo em A, T e G; e/ou - a substituição de um ou ambos de C e G na região -10 tipo selvagem (TACGAT, SEQ ID NO: 7) com um nucleotídeo selecionado independentemente do grupo consistindo em A e T; e/ou - a substituição de C de região -10 tipo selvagem (TACGAT, SEQ ID NO: 7) com um nucleotídeo selecionado independentemente do grupo consistindo em A e T; e/ou - a substituição de C de região -10 tipo selvagem (TACGAT, SEQ ID NO: 7) com T; e/ou - uma região -10 que tem a sequência de nucleotídeos TA-TGAT (SEQ ID NO: 8), TATTAT (SEQ ID NO: 9) ou TACTAT (SEQ ID NO: 10). [0020] In another embodiment, the mutation can result in: - the replacement of one or more nucleotides in the region between the Pribnow box and the ribosome binding site of the galK gene, such as replacement of C in the TTCAGT sequence (SEQ ID NO: 6) downstream from the wild type Pribnow box with a nucleotide selected from the group consisting of A, T and G; and / or - the replacement of one or both of C and G in the -10 wild-type region (TACGAT, SEQ ID NO: 7) with a nucleotide selected independently from the group consisting of A and T; and / or - the replacement of wild-type region C -10 (TACGAT, SEQ ID NO: 7) with a nucleotide selected independently from the group consisting of A and T; and / or - the replacement of wild-type C region -10 (TACGAT, SEQ ID NO: 7) with T; and / or - a -10 region that has the nucleotide sequence TA-TGAT (SEQ ID NO: 8), TATTAT (SEQ ID NO: 9) or TACTAT (SEQ ID NO: 10).
    [0021] c1) seleção de uma cepa mutante tendo resistência a fago, tal como uma aumentada resistência a fago comparada à cepa mãe; e c2) seleção de uma cepa mutante tendo fenótipo Gal+, tal como aumentada atividade de degradação de galactose comparada à cepa mãe. [0021] It should be understood that the mother strain used in a process of the invention may be a gal + strain, preferably a strain that is capable of reducing the pH by at least 1.0 after 16 hours of incubation at 37 degrees C in M17 with 2% galactose (galactose added as the only carbohydrate), inoculated in an amount of at least 10E4 cells per ml of medium. An example of such a strain is a strain in which: - one or more nucleotides in the region between the Pribnow box and the ribosome binding site of the galK gene have been replaced, such as a C substitution in the TTCAGT sequence (SEQ ID NO: 6) downstream of the wild type Pribnow box with a nucleotide selected from the group consisting of A, T and G; and / or - one or both of C and G in the -10 wild-type region (TACGAT, SEQ ID NO: 7) were replaced with a nucleotide selected independently from the group consisting of A and T; and / or - C in the -10 wild-type region (TACGAT, SEQ ID NO: 7) was replaced with a selected nucleotide regardless of the group consisting of A and T; and / or - C in the -10 wild type region (TACGAT, SEQ ID NO: 7) was replaced with T; and / or - the -10 region has the nucleotide sequence TATGAT (SEQ ID NO: 8), TATTAT (SEQ ID NO: 9) or TACTAT (SEQ ID NO: 10). The process of the invention may further comprise one or more stages selected from the group consisting of: c1) selection of a mutant strain having phage resistance, such as increased phage resistance compared to the parent strain; and c2) selection of a mutant strain having a Gal + phenotype, such as increased galactose degradation activity compared to the parent strain.
    [0022] - provimento de uma cepa bacteriana de ácido lático (a cepa mãe); - efetuando mutação de cepa mãe pela introdução de uma mutação na sequência reguladora galK da cepa; - exposição de cepa mãe mutada a um bacteriófago que é capaz de lisar a cepa mãe, tal como um fago selecionado do grupo consistindo em CHPC658, CHPC1057, CHPC1089 e CHPC1152; - opcionalmente incubando as células bacterianas expostas com um meio de crescimento; e - seleção de uma cepa mutante tendo resistência a fago, tal como uma aumentada resistência a fago comparada à cepa mãe. [0022] In one embodiment the process of the present invention refers to a process for manufacturing a lactic acid bacterium, comprising the steps of: - provision of a bacterial strain of lactic acid (the parent strain); - mutating the mother strain by introducing a mutation in the galK regulatory sequence of the strain; - exposure of the mutated mother strain to a bacteriophage that is capable of lysing the mother strain, such as a phage selected from the group consisting of CHPC658, CHPC1057, CHPC1089 and CHPC1152; - optionally incubating the exposed bacterial cells with a growth medium; and - selection of a mutant strain having phage resistance, such as increased phage resistance compared to the parent strain.
    [0023] [0023] The mutant strain obtained through the process of the invention can be a spontaneous mutant, a mutant obtained by mutagenesis of the parent strain by means of, for example, chemical treatment or radiation treatment, or a mutant obtained by means of engineering techniques genetics. An interesting mutant of the invention is a CHCC6008 mutant, esp. a mutant that is gal + and resistant to CHCP1152.
    [0024] [0024] In one embodiment of the process of the invention, the mutant strain is resistant to phage, substantially resistant to phage, and / or has increased resistance to phage compared to the parent strain, and in which the phage is selected from the group consisting of: a bacteriophage that is able to lyse the mother strain, CHPC658, CHPC1057, CHPC1089 and CHPC1152.
    [0025] [0025] It is preferred that the bacterium (the mother strain) is selected from a species selected from the group consisting of Lactococcus spp., Streptococcus spp. (e.g. Streptococcus thermophilus), Lactobacillus spp., Leuconostoc spp., Pseudoleuconostoc spp., Pediococcus spp., Brevibacterium spp., Enterococcus spp., Propionibacterium spp, and Bifidobacterium spp.
    [0026] [0026] In an interesting embodiment of a process of the present invention, the bacterium (or mother strain) is selected from a strain that has one or more characteristics selected from the group consisting of: ability to texturize milk, ability to produce a polyscaride, such such as an exopolysaccharide or a capsular polysaccharide, ability to create viscosity when incubated in milk, and ability to increase shear stress when incubated in milk.
    [0027] [0027] The present patent application also describes bacteria or lactic acid strains that are obtainable through a process of the invention.
    [0028] [0028] Such bacteria or strains generate a viscosity in fermented milk greater than about 70 Pa (Pascal) (such as greater than 73 Pa, greater than 77 Pa or greater than 79 Pa or greater than 80 Pa), measured as tension of shear after 12 hours of growth at 37 ° C, for example, inoculated in an amount of at least 10E4 cells per ml of milk. It is believed that it is possible to obtain strains that generate viscosity in fermented milk of up to 100 Pa, up to 120 Pa, up to 150 Pa, or even up to 200 Pa. Examples of ranges for obtainable viscosity are: 70 to 200 Pa, 75 to 150 Pa , 78 to 120 Pa, 79 to 100 Pa, and 80 to 90 Pa.
    [0029] [0029] Especially, the present invention relates to a strain of S. thermophilus, which is capable of generating a viscosity of 79 to 100 Pa in fermented milk.
    [0030] [0030] More specifically, the invention provides a bacterial strain belonging to the species Streptococcus thermophilus, selected from the group consisting of: CHCC11977 (DSM22935), and CHCC13140 (DSM 24023) ,. Specifically, the present invention relates to the CHCC11977 strain.
    [0031] [0031] The present invention also relates to a bacterial strain belonging to the species Lb delbrueckii subsp. bulgaricus, said strain being selected from the group consisting of CHCC12813 (DSM24074) and CHCC12841. Interesting strains are those that generate a shear stress in fermented milk greater than about 60 Pa (such as greater than 65 Pa, greater than 69 Pa or greater than 72 Pa), measured after 12 hours of growth at 37 degrees Celsius, for example example, inoculated in an amount of at least 10E4 cells per ml of milk. Especially interesting are those generating a shear stress in fermented milk in the range of 60 to 100 Pa (such as from 65 to 90 Pa, from 69 to 85 Pa or from 72 to 80 Pa), measured after 12 hours of growth at 37 degrees C, for example, inoculated in an amount of at least 10E4 cells per ml of milk.
    [0032] [0032] Still in one aspect the present patent application describes a bacterium or strain of lactic acid or mutant or variant of the invention, which generates a gel stiffness in fermented milk greater than about 110 Pa (such as greater than 115, greater than 120 or greater than 125 Pa), measured after 12 hours of growth at 37 degrees C, for example, inoculated in an amount of at least 10E4 cells per ml of milk. It is presently preferred that the gel stiffness is within the range of 110 to 200 Pa, or more preferred within the range of 120 to 190 Pa or 125 to 180 Pa. The bacterium or strain may belong to the species Streptococcus thermophilus or Lactobacillus delbrueckii subsp. bulgari-cus Especially, a strain of S. thermophilus is described, which is capable of generating a gel rigidity of 125 to 175 Pa in fermented milk.
    [0033] [0033] In an interesting embodiment, the present invention relates to a bacterium or strain of lactic acid, which belongs to the species Lb. delbrueckii subsp. bulgaricus. Interesting examples of this realization are a bacterium or strain, which generates a viscosity in fermented milk greater than about 60 Pa (such as greater than 65 Pa, greater than 69 Pa or greater than 72 Pa), measured as shear stress after 12 hours growth at 37 degrees C, for example, inoculated in an amount of at least 10E4 cells per ml of milk, and / or a bacterium or strain, which generates a viscosity in fermented milk in the range of 60 to 100 Pa (such as 65 to 90 Pa, from 69 to 85 Pa or from 72 to 80 Pa), measured as shear stress after 12 hours of growth at 37 degrees C, for example, inoculated in an amount of at least 10E4 cells per ml of milk.
    [0034] [0034] In another aspect, the present invention relates to a composition comprising bacteria or a lactic acid strain of the invention, such a bacterium belonging to the CHCC11977 strain. It is preferred that such a composition comprises at least 10 x 10 CFU (cell forming units) of said bacterium.
    [0035] - uma cepa pertencendo a uma espécie Lactobacillus, tal como um Lactobacillus delbrueckii subsp. bulgaricus (sinônimo: Lactobacillus bulgaricus), um L. johnsonii, ou uma cepa L. fermentum; e - uma cepa de bactéria de ácido lático da invenção, tal como uma cepa pertencendo à espécie Streptococcus thermophilus, por exemplo, uma cepa selecionada do grupo consistindo em CHCC11977 (DSM22935), e CHCC13140 (DSM 24023), tal como uma composição em que a cepa pertencendo a espécie LActobacillus é uma cepa pertencendo a um polissacarídeo (tal como um heteropolissacarídeo, ho-mopolissacarídeo) e/ou espécies Lactobacillus produzindo enzima fru-tosil transferase. [0035] In one embodiment, the composition may comprise, either as a mixture or as a kit of parts, - a strain belonging to a species Lactobacillus, such as a Lactobacillus delbrueckii subsp. bulgaricus (synonym: Lactobacillus bulgaricus), an L. johnsonii, or a L. fermentum strain; and - a strain of lactic acid bacteria of the invention, such as a strain belonging to the species Streptococcus thermophilus, for example, a strain selected from the group consisting of CHCC11977 (DSM22935), and CHCC13140 (DSM 24023), such as a composition in which the strain belonging to the species LActobacillus is a strain belonging to a polysaccharide (such as a heteropolysaccharide, ho-mopolysaccharide) and / or Lactobacillus species producing fructosyl transferase enzyme.
    [0036] [0036] The composition of the invention can comprise at least 10exp10 CFU (cell forming units) of a strain belonging to a Lactobacillus species; and / or at least 10exp10 CFU of a strain belonging to the species Streptococcus thermophilus.
    [0037] [0037] In an interesting embodiment, the composition of the invention comprises at least 10exp10 CFU (cell forming units) of a strain belonging to a polysaccharide (such as a homopolysaccharide) and / or a Lactobacillus species producing a fructosyl transferase enzyme; and at least 10exp10 CFU of a strain belonging to the species Streptococcus thermophilus.
    [0038] [0038] The composition can be used as a starter culture, and can be in frozen, dried - frozen or liquid form.
    [0039] [0039] Still in one aspect, the present invention relates to a process for producing a fermented milk product, comprising fermenting a milk substrate (such as cow's milk) with a lactic acid bacterium of the invention, a strain of invention, or a composition of the invention.
    [0040] [0040] This process may further comprise fermentation of milk substrate with a strain belonging to a Lactobacillus species, such as a strain of L. bulgaricus or L. fermentum, for example, a strain selected from the group consisting of CHCC10019, CHCC10935, or CHCC3984 , and mutants and variants of any of these variants. For example, the milk substrate is fermented with a composition, strain or bacterium of the invention, such as a strain belonging to the species Streptococcus thermophilus before, during, or after fermentation with a strain belonging to a Lactobacillus species, or, the milk substrate is fermented with a strain or bacterium belonging to the species Streptococcus thermophilus during fermentation with a strain belonging to the species Lactobaccilus producing polysaccharide.
    [0041] [0041] The process of the invention for producing a fermented milk product may comprise adding an enzyme to the milk substrate before, during and / or after fermentation, such as an enzyme selected from the group consisting of: an enzyme capable of cross-linking proteins, transglutaminase, an aspartic protease, chymosin, and rennet.
    [0042] [0042] The process can be used to produce a dairy product, such as a fermented milk product (for example, yogurt or butter milk) or a cheese (for example, fresh cheese or filata). The fermented milk product can, for example, be a stirred type product, a drinkable product, or a fixed type product. The dairy product may optionally comprise an ingredient selected from the group consisting of: a fruit concentrate, a syrup, a probiotic bacterial culture, a coloring agent, a thickening agent, a flavoring agent and a preserving agent.
    [0043] [0043] Thus, a fermented milk product obtainable through the process of the invention is described, which optionally comprises an ingredient selected from the group consisting of: a fruit concentrate, a syrup, a probiotic bacterial culture, a coloring agent, a thickening agent, a flavoring agent, and a preservative; and / or which is optionally in the form of a stirred type product, a fixed type product, or a drinkable product.
    [0044] [0044] Also, a dairy product is described, which is manufactured by fermenting a milk substrate (such as cow's milk) with a lactic acid bacterium of the invention (for example, a strain belonging to the species Streptococcus thermophilus, such as DSM 22884) and a species of lactic acid bacteria selected from Lactobacillus bulgaricus and Lactobacillus fermentum (such as CHCC10019 (DSM19252), CHCC3984 (DSM19251) and CHCC2008 (DSM22584)).
    [0045] [0045] In an interesting embodiment, a dairy product prepared by the process of the invention has a viscosity / texture of more than 100 Pa (such as more than 102 or more than 104 Pa), measured as shear stress, for example, after 12 hours of growth at 37 degrees C in milk. In a presently preferred embodiment, the viscosity of more than 100 Pa is obtained by growing the bacterial cell alone, but higher viscosity values can be obtained by adding chemical compounds, such as starch, gelatin, a carrageenan, etc.
    [0046] [0046] In another embodiment, the dairy product has a viscosity / texture in the range of 100 to 200 Pa, such as in the range of 100 to 150 Pa, or in the range of 105 to 125 Pa, measured as shear stress .
    [0047] [0047] Still in one embodiment, the dairy product is a drinkable product, for example, a drinkable yogurt.
    [0048] Also described here are new bacteriophages usable in a process of the invention, such as a bacteriophage selected from the group consisting of CHPC658 (DSM 23961), CHPC1057, CHPC1089 and CHPC1152 (DSM 23994), and their mutants and variants, such as mu -tantes and variants that are capable of smoothing the strains mentioned here, for example, the strain CHCC6008.
    [0049] [0049] Still, new bacterial strains are described, usable as parent strains in a process of the invention, such as strains selected from the group consisting of CHCC11342 (DSM22932), CHCC10019 (DSM19252), CHCC11379 (DSM 22884), CHCC11976 (DSM 22934) , and its mutants.
    [0050] [0050] As used herein, the term "lactic acid bacteria" means a gram-positive, microaerophilic or anaerobic bacterium, which ferments sugars with the production of acids including lactic acid such as the predominantly produced acid, acetic acid and propionic acid. The most industrially useful lactic acid bacteria are found within the order "Lactobacillales" which includes Lactococcus spp., Streptococcus spp., Lactobacillus spp., Leuconostoc spp., Pseudoleuconostoc spp., Pediococcus spp., Brevibacterium spp., Enterococcus spp., Enterococcus spp. and Pro-pionibacterium spp. In addition, bacteria producing lactic acid belonging to the group of strict anaerobic bacteria, bifidobacteria, i.e., Bifidobacterium spp., Are generically included in the group of lactic acid bacteria. These are often used as food crops alone or in combination with other lactic acid bacteria. Lactic acid bacteria, including bacteria of the species Lactobacillus sp. and Streptococcus thermophilus, are normally supplied to the dairy industry either as frozen or dried cultures - frozen for bulk spreader propagation or as so-called "Tina Direto" (DVS) cultures, intended for direct inoculation into a pot or fermentation tank for the production of a dairy product, such as a fermented milk product. Such cultures are generally referred to as "starter cultures" or "starters".
    [0051] [0051] The term "milk" is to be understood as the milk secretion obtained by milking any mammal, such as cows, sheep, goats, buffaloes or camels. In a preferred embodiment, the milk is cow's milk. The term milk also includes protein / fat solutions made from plant materials, for example, soy milk.
    [0052] [0052] The term "milk substrate" can be any processed and / or raw milk material that can be subjected to fermentation according to the process of the invention. Thus, useful milk substrates include, but are not limited to, solutions / suspensions of any milk or milk-like products comprising protein, such as low-fat or whole milk, skim milk, butter milk, reconstituted milk powder, milk condensate, dried milk, buttermilk, buttermilk permeate, lactose, lactose crystallization mother liquor, buttermilk protein concentrate, or cream. Obviously, the milk substrate can originate from any animal, for example, being substantially pure mammalian milk, or reconstituted powdered milk.
    [0053] [0053] Preferably, at least part of the protein in the milk substrate is from proteins occurring naturally in milk, such as casein or whey protein. However, some of the protein may be proteins that do not occur naturally in milk.
    [0054] [0054] The term "milk" is to be understood as the milk secretion obtained by milking any mammal, such as cows, sheep, goats, buffaloes or camels. In a preferred embodiment, the milk is cow's milk.
    [0055] [0055] Before fermentation, the milk substrate can be homogenized and pasteurized according to the processes known in the art.
    [0056] [0056] "Homogenization" as used herein means intensive mixing to obtain a soluble suspension or emulsion. If homogenization is carried out before fermentation, it can be carried out in order to break down the milk fat into smaller sizes so that it does not separate more from the milk. This can be accomplished by forcing milk at high pressure through small holes.
    [0057] [0057] "Pasteurization" as used herein means treatment of the milk substrate to reduce or eliminate the presence of living organisms, such as microorganisms. Preferably, pasteurization is achieved by maintaining a specified temperature for a specified period of time. The specified temperature is usually obtained by heating. The temperature and duration can be selected to kill or inactivate certain bacteria, such as harmful bacteria. A quick cooling step can follow.
    [0058] [0058] "Fermentation" in the processes of the present invention means means for converting carbohydrates to alcohols or acids through the action of a microorganism. Preferably, fermentation in the processes of the invention comprises conversion of lactose to lactic acid.
    [0059] [0059] Fermentation processes to be used in the production of fermented milk products are well known and those skilled in the art will know how to select appropriate process conditions, such as temperature, oxygen, quantity and characteristics of microorganism (s) and time of process. Obviously, fermentation conditions are selected in order to support the achievement of the present invention, that is, to obtain a dairy product in solid or liquid form (fermented milk product).
    [0060] [0060] The term "agitated type product" refers specifically to a fermented milk product that sustains a mechanical treatment after fermentation, resulting in a breakdown and liquefaction of the clot formed under the fermentation stage. Mechanical treatment is typically, but not exclusively, achieved through agitation, smoothing, filtration, or gel homogenization, or by mixing it with other ingredients. Stirred type products typically but not exclusively have a 9-15% milk non-fat solids content.
    [0061] [0061] The term "fixed type product" includes a milk-based product that has been inoculated with a starter culture, for example, a starter culture, and packed after the inoculation step and then fermented in the packaging.
    [0062] [0062] The term "drinkable product" includes drinks such as "drinking yogurt" and the like. The term "drinking yogurt" typically covers a milk product produced by fermentation through the combination of Lactobacillus and Streptococcus thermophilus. Drinking yogurt typically has a solid non-fat milk content of 8% or more. In addition, the live culture count for drinking yogurt drinks is typically at least 10E6 cell-forming units (CFU) per mL.
    [0063] [0063] "Drinkable product" according to the present invention includes any drinkable product based on acidulated milk substrates, as well as fermented milk drinks and liquid yogurt drinks. In the processes of the present invention, acidulation is carried out as a fermentation with a microorganism, optionally an acid is added, such as an organic acid (for example, lactic acid, lactobionic acid or GDL).
    [0064] [0064] Drinkable products according to the invention are drinkable in the sense that they are in liquid form and consumed as beverages, that is, they are suitable for drinking instead of being ingested with a spoon. "In liquid form" means that products are in the fluid state of matter exhibiting a characteristic ease of flow. Thus, the shape of a liquid is usually determined by the container it fills, unlike, for example, a gel-like substance, which is soft but does not flow freely, such as, for example, yogurt or pudding. Drinkable products according to the invention can have a viscosity allowing the consumer to drink the products using a straw if desired.
    [0065] A drinkable product according to the present invention can have a pH of less than 4.6, preferably less than 4.4, more preferably less than 4.2 and even more preferably about pH 4 or less. In one aspect, the drinkable product has a pH of less than 3.8, such as less than 3.6.
    [0066] [0066] A drinkable product according to the invention can have a fat content of 0 to 20%, preferably below 1.5%, below 1% or below 0.5%, more preferably about 0, 1% or less. The drinkable product may have a non-fat solid milk content of less than 20%, preferably less than 8.5%, less than 8%, less than 7.5%, less than 7%, less than 6.5 % or less than 6%, more preferably about 5%.
    [0067] [0067] A drinkable product according to the invention can have a protein content between 0.5 and 4%. In a preferred aspect, the drinkable product has a protein content below 1%. In another preferred aspect, the drinkable product has a protein content of between 2% and 3%.
    [0068] A drinkable product according to the invention can have a shelf life of more than 7 days, preferably more than 14 days, more preferably more than 28 days, such as more than 3 months.
    [0069] [0069] A drinkable product according to the present invention can have improved settling stability. Stability can be determined after the drinkable product has been stored for an appropriate number of days by measuring the height of the whey collected over the surface due to syneresis. It can also be determined after accelerated syneresis, such as by centrifugation.
    [0070] [0070] For a drinkable product, for example, drinking yogurt, a high shear treatment (for example, homogenization) after fermentation is usually necessary to break the protein network in order to obtain uniform, homogeneous and drinkable products. Breaking the network implies that drinking yogurts have reduced sedimentation stability, resulting in protein sedimentation to the bottom during shelf life. High levels of fat and high protein content increase sedimentation stability, while low-fat products (0-0.5% fat) with low protein levels (1-2.5%) usually require the addition of a stabilizer to prevent protein sedimentation.
    [0071] [0071] As used herein, the term "bacteriophage" has the conventional meaning as understood in the art, that is, a virus that selectively infects one or more bacteria. Many bacteriophages are specific to a particular genus or species or strain of bacteria. The term "bacteriophage" is synonymous with the term "phage". Bacteriophages can include, but are not limited to, bacteriophages that belong to any of the following virus families: Corticoviridae, Cystoviri-dae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, orTectiviridae. The bacteriophage can be a lytic bacteriophage or a lysogenic bacteriophage. A lytic bacteriophage is one that follows the lytic pathway through termination of the lytic cycle, rather than entering the lysogenic pathway. A lytic bacteriophage undergoes viral replication leading to lysis of the cell membrane, destruction of the cell, and progeny release of bacteriophage particles capable of infecting other cells. A lysogenic bacteriophage is one capable of entering the lysogenic pathway, in which the bacteriophage becomes a dormant passive part of the cell genome before the end of its lytic cycle.
    [0072] [0072] In one embodiment, the lactic acid bacterium according to the present invention is resistant to one or more bacteriophages or one or more sets of bacteriophages. In another embodiment, the lactic acid bacterium according to the present invention is resistant to the same bacteriophage as a strain deposited according to the present invention is resistant. In the present context, the term "phage robust" is used interchangeably with the term "phage resistant".
    [0073] [0073] In the present context, the term "mutant" is to be understood as a strain derived, or a strain that can be derived, from a strain of the invention (or the mother strain) by, for example, genetic engineering, treatment chemical and / or radiation. It is preferred that the mutant is a functionally equivalent mutant, for example, a mutant that has substantially the same, or improved, properties (for example, with respect to texture, shear stress, viscosity, gel stiffness, mouth coating, aroma , post acidulation, acidulation speed, and / or phage robustness) as the mother strain. Such a mutant is a part of the present invention. In particular, the term "mutant" refers to a strain obtained by subjecting a strain of the invention to any conventionally used mutagenization treatment including treatment with a chemical mutagen such as ethane methane sulfonate (SEM) or N-methyl-N'-nitro -N-nitroguanidine (NTG), UV light, or a naturally occurring mutant. A mutant may have undergone several mutagenization treatments (a single treatment should be understood as a mutagenization step followed by a selection / separation step), but it is currently preferred that no more than 20, or no more than 10, or not more than 5, treatments (or separation / selection steps) are performed. In a presently preferred mutant, less than 5%, or less than 1% or even less than 0.1% of nucleotides in the bacterial genome were displaced with another nucleus, or suppressed, compared to the parent strain. In the present context, the term "variant" should be understood as a strain that is functionally equivalent to a strain of the invention, for example, having substantially the same, or improved, properties, for example, with respect to texture, shear stress, viscosity, gel stiffness, mouth coating, aroma, acidification post, acidulation speed, and / or phage robustness). Such variants, which can be identified using appropriate separation techniques, are a part of the present invention.
    [0074] [0074] In the present context, "texture" is measured as shear stress after 12 hours of growth at 37 ° C. The SI unit for shear stress and gel stiffness is pascal (Pa).
    [0075] [0075] An assay to be used for texture analysis:
    [0076] [0076] The day after incubation, the fermented milk was brought to 13 ° C and gently stirred using a stick adapted with a perforated disc until the sample was homogeneous. The sample's rheological properties were evaluated using a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a C25 coaxial measurement system. The viscosimetry test was done with shear rates ranging from 0.27 to 300 1 / s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were noted. Delay and integration times were 5 s and 10 s, respectively.
    [0077] [0077] The use of terms "one" and "one" and "o" and similar referents in the context of describing the invention (especially in the context of the claims that follow) is to be constructed to cover both the singular and the plural , unless otherwise stated or clearly contradicted by the context. The terms "comprising", "having", "including" and "containing" are to be construed as open-ended terms (i.e., "including, but not limited to"), unless otherwise noted. Recitation of ranges of values here is merely intended to serve as an individual reference shorthand process for each separate value falling within the range, unless otherwise indicated here, and each separate value is incorporated into the specification as if it were there. recited individually. All of the processes described herein may be performed in any appropriate order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (for example, "such as") provided herein, is intended merely to better illuminate the invention and does not have a limitation on the scope of the invention unless otherwise claimed . No language in the specification should be constructed as indicating any unclaimed elements as essential to the practice of the invention. Captions for drawing
    [0078] [0078] Figure 1 shows the shear stress of the positive galactose strain CHCC11342 and the positive phage resistant mutant for galactose CHCC11977 measured with a StressTech rheometer. Shear stress was measured in clotted milk after growing overnight in 37 ° C milk.
    [0079] [0079] Figure 2 shows the shear stress of CHCC10019 phage-resistant mutants measured with a StressTech rheometer. The shear stress was measured in clotted milk after growing overnight in milk at 37 ° C.
    [0080] [0080] Figure 3 shows the gel stiffness of CHCC12339, a phage-resistant mutant of CHCC9204, measured with a StressTech rheometer. Gel stiffness was measured in clotted milk after growing overnight in milk at 37 ° C.
    [0081] [0081] Figure 4 shows the gel rigidity of CHCC13140, CHCC5086 phage-resistant mutant, measured with a StressTech rheometer. The shear stress was measured in clotted milk after growing overnight in milk at 37 ° C. Experimental Example 1: Development of phage-resistant Streptococcus thermophilus strains with improved texture properties Development of CHCC11977
    [0082] [0082] The mother strain CHCC11342 was obtained as described in example 5. The strain is a mutant of CHCC6008 and considered to be a S. thermophilus strain fermenting galactose.
    [0083] [0083] The strain CHCC11977 was isolated on M17 agar plate after coating 0.1 ml of an overnight culture of M17 from CHCC11342 together with 0.1 ml of CHPC1152 phage containing 10E09 (10exp9) phage particles per ml and incubation for two days at 37 ° C. A mutant, called CHCC11977, had the colony purified three times and again tested in a plate test on M17 agar plates at 37 ° C using phage CHPC1152 in which phage resistance was confirmed (no single plaque observed). The mutant strain was then also tested in M17 broth at 37 ° C in the presence of CHPC1152 phage. CHCC11977 retained its phage resistance also in liquid culture, while CHCC11342, as expected, was attacked by CHPC1152.
    [0084] [0084] CHCC11977 was also tested on milk at different temperatures (without the addition of infection phage) showing an acidulation activity comparable to the mother strain CHCC11342. Texture analysis of CHCC11342 in fermented milk
    [0085] [0085] The day after the incubation, the fermented milk was brought to 13 ° C and stirred gently by means of a stick adapted with a perforated disc until the sample was homogeneous. The rheological properties of the sample were evaluated on a rheometer (StreeTech, Re-ologica Instruments, Sweden) equipped with a C25 coaxial measurement system.
    [0086] [0086] The viscosimetry test was done with shear rates ranging from 0.27 to 300 1 / s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were noted.
    [0087] [0087] Delay and integration times were 5 s and 10 s, respectively. For further analysis, shear stress at 300 s-1 was chosen.
    [0088] [0088] The rheometer results showed that a shear stress value of 73.0 Pa compared to CHCC6008 with a shear stress value of 68.0 Pa, see figure 1. Texture analysis of CHCC11977 in fermented milk
    [0089] [0089] Fermented milk was obtained, and texture-related properties were analyzed, as described above for the positive phage-resistant mutant - gal.
    [0090] [0090] The rheometer results showed that CHCC11977 had a shear stress value that was further improved by 10% compared to CHCC11342 (shear stress value of 80.0 Pa for CHCC11977 compared to 73.0 Pa for mother strain CHCC11342, see figure 1). In addition, gel rigidity (G *) was increased by 20% for the phage-resistant mutant CHCC11977 which showed a value of 126.0 Pa compared to CHCC11342 (gel rigidity 104.0 Pa). With this, it was possible to significantly improve the important parameters of rheology shear stress and gel stiffness through isolation of a phage-resistant mutant from a galactose positive mother strain. Sequencing of the galK promoter region of CHCC11342
    [0091] [0091] To reveal the type of mutation for the positive mutant galactose CHCC11342 the start of the galK gene (encoding the galactokinase from S. thermophilus) was sequenced. For CHCC11342 a mutation in the galK promoter region has been identified (see sequences below). The mutation occurred three nucleotides downstream of the -10 promoter box of the galK gene leading to a nucleotide shift from C to A. CHCC11342 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTAAGTATAAACAAAAAGAATAAGTGAGATACATC SEQ ID No: 1 CHCC6008 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQ ID No: 2 AY704368 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQ ID No: 3 Consensus AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQ ID No: 4-35 -10 RBS
    [0092] [0092] Promoter region of the galCC gene of CHCC11342. The point mutation within the galK promoter region CHCC11342 is identified with a gray color code. The published galK sequence of S. thermophilus ST111 (Genbank accession no. AY704368) is indicated for comparison-35: promoter box -35; -10: promoter box -10; RBS: ribosome binding site. Still phage-resistant mutants
    [0093] [0093] To reveal a possible relationship between phage resistance of positive phenotype for galactose five additional phage-resistant mutants were isolated on M17 galactose agar plates from strain CHCC6008 (gal-) which is the parent strain of CHCC11342 (gal +) . All five mutant-resistant phage, CHCC11396, CHCC11397, CHCC11398, CHCC11399, and CHCC11340 (phage resistant CHPC1152) were unable to ferment galactose meaning that the gal + phenotype is not directly related to phage resistance. On the other hand, it was demonstrated through the plate assay that CHCC11342 (gal +) was still sensitive to CHPC1152 phage. Example 2: Development of Lactobacillus delbrueckii subsp. bulgaricus with improved texture properties
    [0094] [0094] From the mother strain CHCC10019 (DSM19252), phage-resistant mutants were isolated as follows:
    [0095] [0095] Mutants were separated from MRS agar plates containing 10 mM CaCl2 / 10 mM MgCl2 after coating 0.1 ml of a culture overnight in MRS of CHCC10019 along with 0.1 ml of a CHPC658 phage lysate containing 10E06 particles of phage per mL and anaerobic incubation for two days at 37 ° C. Thirty mutants were isolated and tested in stripe - crossed in the direction of phage CHPC658. Twenty - nine mutants appeared resistant in the cross - streak test, and the colony was then purified three times on MRS agar plates at 37 ° C.
    [0096] [0096] The 29 mutants were tested on microtiter plates for acidulation profile and phage resistance. Two microtiter plates were prepared with milk and each plate was inoculated with 2% of the respective mutant. For one plate, 2% salt - peptone diluent (control) was added to each well, and to the other 2% CHPC658 microtiter plate containing 10E06 phage particles per mL were added. The two plates were incubated at 37 ° C for two days, and the pH of each well was recorded every 12 minutes. All mutants were resistant to phage compared to the mother strain CHCC10019, which was attacked by phage CHPC658.
    [0097] [0097] Twelve mutants were chosen based on the acidulation profile in MRS and milk (similar to the mother strain) and the viscosity of the strains. Analysis of CHCC10019 phage-resistant mutants for texture properties in fermented milk
    [0098] [0098] After incubation of twelve mutants and mother strain CHCC10019 all night in milk at 37 ° C, the fermented milk was adjusted to 13 ° C and slightly agitated using a rod adapted with a disc containing holes until the homogeneity of each sample . The rheological properties of each sample were evaluated on a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a C25 coaxial measurement system.
    [0099] [0099] The viscosimetry test was done with shear rates ranging from 0.27 to 300 1 / s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were noted. Delay and integration times were 5 s and 10 s, respectively. For further analysis, shear stress at 300 s-1 was chosen.
    [0100] [00100] The results of the rheology measurements showed that all twelve mutants (such as CHCC12813 and CHCC12841) had an improved viscosity, measured as shear stress, compared to CHCC10019. The highest shear stress value was obtained for CHCC12841 (74.0 Pa) while CHCC10019 had a shear stress value of 58.0 Pa, see figure 2. In the figure, the rheology data for the twelve mutants resistant to phage are shown. All mutants had an increase in shear stress ranging from 10% to 28% compared to CHCC10019. Based on data on acidulation and rheology activity when the mutants were grown in co-culture with other strains CHCC12813 was selected as the most promising candidate of the isolated mutants for further application testing.
    [0101] [00101] This experiment demonstrates that the important shear stress parameter of a bacterial strain will be significantly improved by isolating phage-resistant mutants from the strain. Example 3: Isolation of phage-resistant mutants from Streptococcus thermophilus strain CHCC9204
    [0102] [00102] From the mother strain CHCC9204, registered in Chr. Hansen culture collection, a phage-resistant mutant was isolated. On 2% -M17 lactose agar plates with 10 mM MgCl2 / CaCl2 after coating 0.1 ml of a CHCC9204 culture overnight on M17 lactose along with 0.1 ml of CHPC1057 phage containing 1x10exp09 phage particles per ml and incubation all night at 37 ° C.
    [0103] [00103] Several strains enter a strain, called CHCC12339, had colony purified three times and again tested in a plate test on M17 lactose agar plates at 37 ° C using phage CHPC1057 for phage challenge, and phage resistance was confirmed (no plaque) observed on a test plate). CHCC12339 was also tested on milk showing an acidulation activity comparable to the mother strain. Analysis of texture properties of CHCC12339 phage-resistant mutant in fermented milk
    [0104] [00104] After CHCC12339 mutant and CHCC9204 mother strain were incubated overnight in milk at 37 ° C, the fermented milk was brought to 13 ° C and gently stirred using a stick adapted with a perforated disc until each sample was homogeneous. . The rheological properties of each sample were evaluated in a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a C25 coaxial measurement system.
    [0105] [00105] The viscosimetry test was done with shear rates ranging from 0.27 to 300 1 / s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were noted. Delay and integration times were 5 to 10 s, respectively. For further analysis, a shear stress of 300 s-1 was chosen.
    [0106] [00106] The results of rheology measurements showed that mutant CHCC12339 leads to a 22% increase in gel stiffness (G *) compared to CHCC9204, see figure 3. In the figure, the gel stiffness values (G *) for the phage-resistant mutant CHCC12339 (78.0 Pa) and parent strain CHCC9204 (64.0 Pa) are compared. Example 4: Isolation of phage-resistant mutants from Streptococcus thermopphilus strain CHCC5086
    [0107] [00107] From the mother strain CHCC5086, registered in Chr. Hansen culture collection, a phage-resistant mutant was isolated. The mutant was isolated on 2% lactose agar - M17 plates with 10 mM MgCl2 / CaCl2 after coating 0.1 ml of a culture overnight on 2% lactose - M17 from CHCC5086 together with 0.1 ml of CHPC1089 phage containing 1x10exp08 phage particles per ml and incubation overnight at 37 ° C. Among several mutants a strain, called CHCC13140, had the colony purified three times and again tested in a plate on M17 lactose agar plates at 37 ° C using phage CHPC1089 for phage challenge, and phage resistance was confirmed (no plaque observed in test plate). CHCC13140 was also tested in a milk addition test showing an acidulation activity comparable to the mother strain. Analysis of texture properties of CHCC13410 phage-resistant mutant in fermented milk
    [0108] [00108] After CHCC13140 mutant and CHCC5086 mother strain were incubated overnight in milk at 37 ° C, the fermented milk was brought to 13 ° C and gently stirred using a stick adapted with a perforated disc until each sample was homogeneous. The rheological properties of each sample were evaluated on a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a C25 coaxial measurement system.
    [0109] [00109] The viscosimetry test was carried out with shear rates ranging from 0.27 to 300 1 / s and, 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were noted. Delay and integration times were 5 s and 10 s, respectively. For further analysis, shear stress at 300 s-1 was chosen.
    [0110] [00110] The results of rheology measurements showed that mutant CHCC13140 leads to a 14% shear stress increase compared to CHCC5086, see figure 4. In the figure, the data for shear stress for the phage-resistant mutant CHCC13140 (stress shear strength of 33.0 Pa) and mother strain CHCC5086 (28.0 Pa) are compared. Example 5: Preparation of a positive mutant for galactose from a Streptococcus strain Generic process for obtaining gal + strains
    [0111] [00111] Before isolation of mutant the mother strain (for example, CHCC6008) was streaked on M17 agar plates with 2% galactose (gal-M17 plates). CHCC6008 does not grow on galactose as the sole source of carbohydrate, so the parent strain is considered to be gal-.
    [0112] [00112] Cultures throughout the night of the mother strain were then coated on gal-M17 plates and several colonies can be isolated after two days of growth at 37 ° C.
    [0113] [00113] Several mutants were purified on gal-M17 plates and tested again in M17 broth containing 2% galactose as the sole carbohydrate. A mutant can be obtained through, for example, genetic engineering, radiation and / or chemical treatment, or the mutant can be a spontaneous mutant.
    [0114] [00114] A mutant was considered positive for galactose when pH was reduced by a value of at least 1.0 after 16 hours of incubation at 37 degrees C in M17 with 2% galactose (galactose added as the sole carbohydrate), inoculated in an amount of at least 10E4 cells per ml of medium. While CHCC6008 does not significantly decrease the pH in gal - M17 broth, CHCC11342, one of the purified mutants, reached a pH of 5.4 after 16 hours at 37 ° C, and was therefore considered a mutant fermenting galactose (gal +) of CHCC6008. Isolation of galactose fermentation strains
    [0115] [00115] Mutants were isolated as a mutant fermenting S. thermophilus strain CHCC6008 (= ST6008, DSM18111) galactose. CHCC6008 cells did not undergo mutagenesis with any mutagenic compound or through UV light prior to the mutant isolation step. The strains isolated therefore appear to be spontaneous mutants positive for CHCC6008 galactose.
    [0116] [00116] Before isolation of CHCC6008 mutant it was streaked on M17 agar plates with 2% galactose (gal - M17 plates). CHCC6008 does not grow on galactose as the only carbohydrate source.
    [0117] [00117] CHCC6008 overnight culture was then coated on gal - M17 plates and several colonies can be isolated after two days of growth at 37 ° C. Several mutants were purified on gal - M17 plates and tested again in M17 broth containing 2% galactose as the sole carbohydrate.
    [0118] [00118] While CHCC6008 does not significantly decrease the pH in gal - M17 broth, CHCC11379, one of the purified mutants, reached a pH of 5.3 after 10 hours at 37 ° C, and was therefore considered a CHCC6008 mutant fermenting galactose.
    [0119] [00119] Strains CHCC11342 and CHCC11976 were isolated in the same way. Isolation of mutants through genetic engineering
    [0120] [00120] Galactose positive mutants can also be generated by site-directed mutagenesis. Oligonucleotides carrying the mutation nucleotide within the -10 galK promoter box are used to amplify a specific DNA fragment by PCR. The PCR fragment carrying the desired mutation is cloned into a vector plasmid and transformed into the target strain S. thermophilus, and the mutation is integrated into the chromosome and exchanges the wild-type galK promoter region for recombination. Strain isolation is done as above. Texture analysis in fermented milk
    [0121] [00121] The day after incubation, the fermented milk was brought to 13 ° C and gently stirred using a stick adapted with a perforated disc until the sample was homogeneous. The rheological properties of the sample were evaluated on a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a coaxial measurement system C25).
    [0122] [00122] The viscosimetry test was done with shear rates ranging from 0.27 to 300 1 / s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were noted. Delay and integration times were 5 s and 10 s, respectively. For further analysis, shear stress at 300 s-1 was chosen. The rheometer results showed that CHCC11379 had a shear stress that was improved by 10% compared to CHCC6008 (shear stress value 74.0 Pa (Pascals) for CHCC11379 compared with 67.5 Pa for CHCC6008 mother strain. Milk texture analysis
    [0123] [00123] In another experiment CHCC11379 was used as part of a yogurt culture in which strains of S. thermophilus are co-cultivated in skimmed milk at 43 ° C together with a strain of the species Lactobacillus delbrueckii subsp. bulgaricus When the only difference in yogurt production was the use of CHCC11379 instead of CHCC6008 wild type the shear stress was also increased by 10% (105.0 Pa for the yogurt culture containing CHCC11379 compared to 94.7 Pa for the yogurt culture containing CHCC6008). Sequencing of the galK promoter region from CHCC11379
    [0124] [00124] To reveal the type of mutation for the positive mutant gal CHCC11379 the start of the galK gene (encoding the S. thermophilus galactokinase) was sequenced. For CHCC11379 a mutation in the galK promoter region has been identified (see below). The respective mutation is more likely to lead to stronger promoter activity compared to the 6008 parent strain, explaining the positive gal phenotype observed. This is based on the fact that the consensus sequence for the -10 promoter box is "TATAAT", and that a mutation in nucleotide 3 of the -10 box (region) for CHCC6008 ("TACGAT") leads to a -10 box with a greater similarity to the consensus sequence in CHCC11379 ("TATGAT"). CHCC11379 AAAATATTGATTTTCCATGTGAAAGGGGTTATGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQ ID NO: 5 CHCC6008 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQ ID NO: 2 AY704368 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQ ID NO: 3 Consensus AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQ ID NO: 4-35 -10 RBS
    [0125] [00125] Promoter region of the galK gene of CHCC11379. The point mutation within the CHCC11379 galk promoter is indicated with a gray color code. The published galK sequence of S. thermophilus ST111 (Genbank accession no. AY704368) is indicated for comparison. -35: promoter region -35; -10: promoter region -10; RBS: ribosome binding site
    [0126] [00126] Preferred embodiments of this invention are described herein, including the best way known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those skilled in the art by reading the preceding description. Deposits and Expert Solution
    [0127] [00127] The strains Streptococcus thermophilus CHCC11977 and CHCC11342 were deposited in DSDMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhoffenstr. 7B, D-38124 Braunschweig, Germany) under the accession numbers DSM22935 and DSM229, in September, 2002. 2009. CHCC6008 was deposited with DSMZ under accession number DSM 18111 on March 29, 2006.
    [0128] [00128] Bacteriophages CHPC658, CHPC1057 and CHPC1152 were deposited in DSMZ on 08/27/2010, and received deposit numbers DSM23961, DSM23962, and DSM23994, respectively. Still deposits in DSMZ: CHCC10019 (DSM19252) and CHCC3984 (DSM19251): deposit date April 3, 2007; CHCC2008 (DSM22584) and CHCC5086 (DSM22587): deposit date May 19, 2009; CHCC11379 (DSM22884): filing date August 26, 2009; CHCC11976 (DSM22934): deposit date September 8, 2009; CHCC13140 (DSM 24023), CHCC12813 (DSM24074), and CHPC1089 (DSM 24022): deposit date September 29, 2010; CHCC12339 (DSM24090): deposit date October 14, 2010; Streptococcus thermophilus CHCC5086 (DSM22587): deposit date May 19, 2009; CHCC9204 (DSM19243): deposit date March 29, 2007.
    [0129] [00129] The deposits were made under the conditions of the Budapest Treaty in the international recognition of the deposit of microorganisms for the purposes of patent procedure.
    权利要求:
    Claims (11)
    [0001]
    Process for the manufacture of a lactic acid bacterium, characterized by the fact that it comprises the steps of: a) provide a bacterial strain of lactic acid of the species species Streptococcus thermophilus or Lactobacillus bulgaricus as the parent strain; b) exposing the mother strain to a bacteriophage that is able to lyse the mother cell; c) isolating a mutant strain from the mother strain, in which the mutant strain is not lysed by the bacteriophage; d) introducing a mutation in the regulatory sequence region between the Pribnow box and the ribosome binding site in the promoter region of the strain galK gene before, during and / or after step b); wherein said mutant strain generates shear stress and / or gel stiffness higher than the mother strain when used for milk fermentation.
    [0002]
    Process according to claim 1, characterized by the fact that step b) comprises exposing the mother cell to a bacteriophage selected from the group consisting of CHPC658 that was deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH under accession number DSM23961, CHPC1057 which was deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH under accession number DSM23962, CHPC1089 which was deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH under accession number DSM24022 and CHPC1152 which was deposited with Deutsche Sammlenk Mikkorganism under access number DSM23994.
    [0003]
    Process according to claim 1 or 2, characterized by the fact that the said galK regulatory sequence of the strain is introduced by chemical treatment or radiation treatment, or by genetic engineering techniques.
    [0004]
    Process according to any one of claims 1 to 3, characterized in that the mutation is introduced by genetic engineering techniques and results in the replacement of one or more nucleotides in the region between the Pribnow box and the ribosome binding site of the gene galK, such as the replacement of C in the TTCAGT sequence (SEQ ID NO: 6) downstream of the wild type Pribnow box with a nucleotide selected from the group consisting of A, T and G.
    [0005]
    Process according to any one of claims 1 to 4, characterized in that an additional mutation is introduced in the -10 region also known as the GalK gene Pribnow box.
    [0006]
    Process according to claim 5, characterized by the fact that the mutation is introduced by genetic engineering techniques and results in: - replacement of one or both of C and G in the -10 wild-type region presenting the sequence TACGAT (SEQ ID NO: 7) with a nucleotide selected independently from the group consisting of A and T; and / or - substitution of C from -10 wild type region presenting the sequence TACGAT (SEQ ID NO: 7) with a nucleotide selected independently from the group consisting of A and T; and / or - replacement of C from -10 wild type region presenting the sequence TACGAT (SEQ ID NO: 7) with T; and / or - a -10 region that has the nucleotide sequence TATGAT (SEQ ID NO: 8), TATTAT (SEQ ID NO: 9) or TACTAT (SEQ ID NO: 10).
    [0007]
    Process according to any one of claims 1 to 6, characterized by the fact that it further comprises the step of selecting a mutant strain having a Gal + phenotype, such as increased galactose degradation activity compared to the parent strain.
    [0008]
    Bacterial strain, characterized by the fact that it belongs to the species Streptococcus thermophilus and is selected from the group consisting of: CHCC11977 which was deposited in Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH under accession number DSM22935, CHCC12339 which was deposited in Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH under accession number DSM24090 and CHCC13140 which was deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH under accession number DSM 24023.
    [0009]
    Bacterial strain, characterized by the fact that it belongs to the species Lactobacillus delbrueckii subsp. bulgaricus and is selected from the group consisting of CHCC12813 which was deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH under accession number DSM24074.
    [0010]
    Composition, characterized by the fact that it comprises a bacterial strain as defined in any one of claims 8-9.
    [0011]
    Process for producing a fermented milk product, characterized in that it comprises the fermentation of a milk substrate with a bacterial strain as defined in any one of claims 8-9, or a composition as defined in claim 10.
    类似技术:
    公开号 | 公开日 | 专利标题
    BR112012018882B1|2020-12-01|process for the manufacture of lactic acid bacteria that generates shear stress and / or gel stiffness higher than the mother strain when the bacteria are used for fermentation of milk, bacterial strain, composition comprising said bacteria and process for production of fermented milk product
    EP2473058B1|2017-08-09|Lactic bacterium with modified galactokinase expression for texturizing food products by overexpression of exopolysaccharide
    US10392597B2|2019-08-27|Texturizing lactic acid bacteria strains
    ES2601006T3|2017-02-13|Lactic acid bacteria for yogurt
    BR112020019974A2|2021-01-05|COMPOSITION AND PROCESS FOR THE PRODUCTION OF A FERMENTED MILK PRODUCT UNDERSTANDING THE APPLICATION OF A LACTOSE-DEFICIENT ST.
    BR112014025713B1|2021-11-23|LINEAGE OF LACTIC ACID BACTERIA, COMPOSITION INCLUDING IT, USE AND METHOD FOR THE PREPARATION OF SUCH LINEAGE, METHOD FOR THE PREPARATION OF A FERMENTED MILK PRODUCT AND FERMENTED MILK PRODUCT
    同族专利:
    公开号 | 公开日
    CN105713853A|2016-06-29|
    US20120301575A1|2012-11-29|
    MX2012008089A|2012-08-15|
    MX338822B|2016-05-03|
    JP5905834B2|2016-04-20|
    US9562221B2|2017-02-07|
    JP2013517785A|2013-05-20|
    BR112012018882A2|2017-12-19|
    US9416351B2|2016-08-16|
    KR101695908B1|2017-01-12|
    CN105713853B|2020-07-17|
    JP6401194B2|2018-10-03|
    US20150099273A1|2015-04-09|
    US9060524B2|2015-06-23|
    JP2016082981A|2016-05-19|
    CN102770527B|2016-01-20|
    US8865238B2|2014-10-21|
    DK2529035T3|2018-05-28|
    US20170096635A1|2017-04-06|
    KR20120120382A|2012-11-01|
    CN102770527A|2012-11-07|
    US20160227803A1|2016-08-11|
    ES2672900T3|2018-06-18|
    TR201807378T4|2018-06-21|
    EA201290709A1|2013-05-30|
    US20150322415A1|2015-11-12|
    EA030184B1|2018-07-31|
    WO2011092300A1|2011-08-04|
    PL2529035T3|2018-08-31|
    EP2529035B1|2018-03-14|
    EP2529035A1|2012-12-05|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    CH649196A5|1981-12-16|1985-05-15|Nestle Sa|PROCESS FOR THE MANUFACTURE OF YOGURT.|
    JP3027460B2|1991-12-19|2000-04-04|キッコーマン株式会社|Phage-resistant lactic acid bacteria and method for producing soy sauce using the same|
    PH31093A|1993-08-06|1998-02-05|Nestec Ltd|Lactobacillus bulgaricus having decreased acid production and/or improved aroma and flavor production and food composition comprising said lactobacillus.|
    JP3863958B2|1997-02-03|2006-12-27|株式会社中埜酢店|Phage resistant Bacillus natto and its natto|
    JPH11103854A|1997-09-29|1999-04-20|Snow Brand Milk Prod Co Ltd|Phage-resistant bacterial strain and fermented food using the same|
    US6461607B1|1998-08-24|2002-10-08|Ganeden Biotech, Inc.|Probiotic, lactic acid-producing bacteria and uses thereof|
    US7125698B2|1999-08-09|2006-10-24|Matthew Glenn|Polynucleotides, materials incorporating them, and methods for using them|
    FR2807764B1|2000-04-18|2004-09-10|Agronomique Inst Nat Rech|MUTANTS OF LACTIC BACTERIA OVERPRODUCING EXOPOLYSACCHARIDES|
    AU7253301A|2000-07-24|2002-02-05|Degussa|Nucleotide sequence which codes for the alr gene|
    JP3769223B2|2001-11-22|2006-04-19|日本ミルクコミュニティ株式会社|Post-fermented yogurt|
    GB0205647D0|2002-03-11|2002-04-24|Danisco Cultor Niebull Gmbh|Method of improving food fermentation procedures|
    US20030211218A1|2002-05-13|2003-11-13|Cote Antoine J.|Yogurt production process and products|
    NZ521836A|2002-10-08|2005-07-29|New Zealand Dairy Board|High pressure treatment to reduce microbial spoilage in cultured dairy foods, cooked meats, vegetables and the like|
    FR2852604B1|2003-03-17|2005-05-13|TEXTURING LACTIC ACID BACTERIA|
    WO2004089098A1|2003-04-11|2004-10-21|Novozymes A/S|Dairy product comprising hyaluronic acid|
    ES2242541B1|2004-04-30|2006-12-16|Consejo Superior De Investigaciones Cientificas|FERMENTED PRODUCT WITHOUT LACTOSE FROM DRIED FRUITS OF NON-VEGETABLE FRUITS AND / OR HORCHATA.|
    PL1838839T5|2005-01-06|2020-11-16|Chr. Hansen A/S|Bacteriophage resistant lactic acid bacteria|
    EP2336362B1|2005-08-26|2018-09-19|DuPont Nutrition Biosciences ApS|Use of crispr associated genes |
    CN102690770B|2006-02-24|2014-08-27|科·汉森有限公司|Lactic acid bacteria providing improved texture of fermented dairy products|
    US20100034924A1|2006-06-16|2010-02-11|Christophe Fremaux|Bacterium|
    EP1869983A1|2006-06-23|2007-12-26|Chr. Hansen A/S|Low post-acidifying lactic acid bacteria|
    FR2906536B1|2006-10-03|2008-12-26|Danisco|GENETIC CLUSTER OF STREPTOCOCCUS THERMOPHILUS STRAINS HAVING ACIDIFTING AND TEXTURANT PROPERTIES SUITABLE FOR DAIRY FERMENTATION.|
    BRPI0807230B1|2007-02-02|2018-11-06|Arla Foods Amba|drinkable yogurt, and its manufacturing process|
    DK2173183T3|2007-06-06|2011-01-24|Chr Hansen As|Improvement of Bifidobacteria growth in fermented milk products|
    US20090061046A1|2007-08-02|2009-03-05|Novozymes A/S|Method for producing an acidified milk drink|
    WO2010023178A1|2008-08-28|2010-03-04|Chr. Hansen A/S|Pharmaceuticals comprising a bacterial polysaccharide|
    JP2012531189A|2009-06-30|2012-12-10|セーホーエル．ハンセンアクティーゼルスカブ|Method for the production of fermented dairy products|
    JP2012531190A|2009-06-30|2012-12-10|セーホーエル．ハンセンアクティーゼルスカブ|Method for producing fermented dairy products|
    JP5905834B2|2010-01-28|2016-04-20|セーホーエル．ハンセン アクティーゼルスカブ|Lactic acid bacteria for adding texture to foods selected based on phage resistance|
    BR112012004706B1|2009-09-01|2019-09-10|Chr Hansen As|lactic acid bacterium that carries a mutation in the -10 region of the galk gene, its manufacturing method, composition, dairy product or fermented milk product and method of manufacture|
    PL2582787T3|2010-06-21|2017-07-31|Chr. Hansen A/S|Lactic acid bacteria for yoghurt|
    EA029862B1|2010-10-22|2018-05-31|Кр. Хансен А/С|Texturizing lactic acid bacteria strains|JP5905834B2|2010-01-28|2016-04-20|セーホーエル．ハンセン アクティーゼルスカブ|Lactic acid bacteria for adding texture to foods selected based on phage resistance|
    PL2582787T3|2010-06-21|2017-07-31|Chr. Hansen A/S|Lactic acid bacteria for yoghurt|
    EA029862B1|2010-10-22|2018-05-31|Кр. Хансен А/С|Texturizing lactic acid bacteria strains|
    AR090802A1|2012-04-23|2014-12-10|Chr Hansen As|LACTIC TEXTURIZED LACTIC ACID BACTERIA STRIPES RESISTANT TO AMPICILLIN|
    JP6767114B2|2012-04-25|2020-10-14|セーホーエル．ハンセン アクティーゼルスカブ|Use of lactic acid bacteria to prepare fermented foods with increased natural sweetness|
    DK3116994T3|2014-02-20|2019-10-21|Dsm Ip Assets Bv|PHAGE-SENSITIVE STREPTOCOCCUS THERMOPHILUS|
    WO2017103051A1|2015-12-18|2017-06-22|Chr. Hansen A/S|Lactic acid bacteria for preparing fermented food products with increased natural sweetness and high texture|
    JP2020515265A|2017-03-28|2020-05-28|セーホーエル．ハンセン アクティーゼルスカブ|Lactic acid bacterium composition for preparing fermented food products with enhanced natural sweetness and flavor|
    WO2018220104A1|2017-05-31|2018-12-06|Chr. Hansen A/S|Method of producing streptococcus thermophilus mutant strains|
    CN111433347A|2017-08-28|2020-07-17|科·汉森有限公司|Streptococcus Thermophiluscells for the preparation of, for example, mozzarella cheese|
    AU2020296296A1|2019-06-20|2022-01-27|Chr. Hansen A/S|Use of ST Gal bacteria for producing a fermented milk product with a relatively high stable pH|
    FR3099934A1|2019-08-12|2021-02-19|Institut National De La Recherche Agronomique |PROCESS FOR ISOLATING LACTIC BACTERY STRAINS OVERPRODUCING EXOPOLYSACCHARIDES|
    WO2021151978A1|2020-01-30|2021-08-05|Dsm Ip Assets B.V.|A method for determining an order in which a food product is cultured|
    CN111575209A|2020-05-25|2020-08-25|浙江大学|Method for screening bacteriophage-resistant lactobacillus plantarum strain|
    WO2021240015A1|2020-05-29|2021-12-02|Chr. Hansen A/S|Lactic acid bacteria composition for preparing fermented food products|
    法律状态:
    2018-03-06| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|
    2018-03-27| B15K| Others concerning applications: alteration of classification|Ipc: C12R 1/46 (2006.01), A23C 9/12 (2006.01) |
    2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|
    2019-11-26| B07A| Technical examination (opinion): publication of technical examination (opinion) [chapter 7.1 patent gazette]|
    2020-09-01| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|
    2020-12-01| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 28/01/2011, OBSERVADAS AS CONDICOES LEGAIS. |
    优先权:
    申请号 | 申请日 | 专利标题
    DKPA201000070|2010-01-28|
    DKPA201000070|2010-01-28|
    DKPA201000081|2010-01-29|
    DKPA201000081|2010-01-29|
    DKPA201000519|2010-06-11|
    DKPA201000519|2010-06-11|
    EPPCT/EP2010/062808|2010-09-01|
    PCT/EP2010/062808|WO2011026863A1|2009-09-01|2010-09-01|Lactic bacterium with modified galactokinase expression for texturizing food products by overexpression of exopolysaccharide|
    DKPA201000894|2010-10-01|
    DKPA201000894|2010-10-01|
    DKPA201001051|2010-11-19|
    DKPA201001051|2010-11-19|
    PCT/EP2011/051239|WO2011092300A1|2010-01-28|2011-01-28|Lactic bacterium for texturizing food products selected on basis of phage resistance|
    [返回顶部]